ID: 1165914507_1165914519

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1165914507 1165914519
Species Human (GRCh38) Human (GRCh38)
Location 19:39249375-39249397 19:39249420-39249442
Sequence CCCACCTCATTCTCCATAGTAGC CACCATTTTTTGTAGCAACCTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 346, 3: 7003, 4: 72877} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!