ID: 1165916841_1165916850

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1165916841 1165916850
Species Human (GRCh38) Human (GRCh38)
Location 19:39265715-39265737 19:39265765-39265787
Sequence CCAGGACTCCCCTCGGTGTCGCG GCCTGCTCACGTGGGAGCTCCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 17, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!