ID: 1165923799_1165923812

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1165923799 1165923812
Species Human (GRCh38) Human (GRCh38)
Location 19:39314799-39314821 19:39314848-39314870
Sequence CCCACGGCAGGGCCTCCAGGTTG GGTGGACAGGAAGGCGTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168} {0: 1, 1: 0, 2: 2, 3: 10, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!