ID: 1165924883_1165924908

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1165924883 1165924908
Species Human (GRCh38) Human (GRCh38)
Location 19:39320793-39320815 19:39320844-39320866
Sequence CCAGCCCGGGGGGGCCCCGGGCC GCCATGGTGGGGGGAGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 557} {0: 1, 1: 0, 2: 5, 3: 91, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!