ID: 1165924909_1165924918

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1165924909 1165924918
Species Human (GRCh38) Human (GRCh38)
Location 19:39320845-39320867 19:39320865-39320887
Sequence CCATGGTGGGGGGAGGGCCGGGG GGGGAGGGGGCGCGGTGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 129, 4: 750} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!