ID: 1165928697_1165928711

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1165928697 1165928711
Species Human (GRCh38) Human (GRCh38)
Location 19:39342687-39342709 19:39342724-39342746
Sequence CCGCGGGCGGCGGCGGCGGGCGG CCTCGGGGGGCCGGGCCCCACGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 20, 3: 175, 4: 1815} {0: 1, 1: 0, 2: 0, 3: 22, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!