ID: 1165937411_1165937421

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1165937411 1165937421
Species Human (GRCh38) Human (GRCh38)
Location 19:39397765-39397787 19:39397807-39397829
Sequence CCTGGGCCTAAACACAGCAGCCT ACCGCAGCGGGAGCCAGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 167} {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!