ID: 1165952188_1165952194

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1165952188 1165952194
Species Human (GRCh38) Human (GRCh38)
Location 19:39480732-39480754 19:39480764-39480786
Sequence CCTTTGGTCTCTCTCGGGCTTCC CCCCTCCCCCGCGTTTCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177} {0: 1, 1: 0, 2: 2, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!