ID: 1165953282_1165953299

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1165953282 1165953299
Species Human (GRCh38) Human (GRCh38)
Location 19:39486643-39486665 19:39486687-39486709
Sequence CCTTGGCCAGACATCTGCACCCT GTGTGGGAGTGGGGGGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 200} {0: 1, 1: 0, 2: 5, 3: 85, 4: 872}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!