ID: 1165955313_1165955325

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1165955313 1165955325
Species Human (GRCh38) Human (GRCh38)
Location 19:39498860-39498882 19:39498882-39498904
Sequence CCCGCCCTTGGTCCCTTGGGGCC CGGGTAGCTGCCTGAAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 222} {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!