ID: 1165955313_1165955326

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1165955313 1165955326
Species Human (GRCh38) Human (GRCh38)
Location 19:39498860-39498882 19:39498883-39498905
Sequence CCCGCCCTTGGTCCCTTGGGGCC GGGTAGCTGCCTGAAGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 222} {0: 1, 1: 0, 2: 4, 3: 24, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!