ID: 1165957082_1165957086

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1165957082 1165957086
Species Human (GRCh38) Human (GRCh38)
Location 19:39507669-39507691 19:39507693-39507715
Sequence CCATCTCCGTGGTGCAGTTGGCC GATTCCTTGATGCATTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130} {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!