ID: 1166003020_1166003030

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1166003020 1166003030
Species Human (GRCh38) Human (GRCh38)
Location 19:39889532-39889554 19:39889572-39889594
Sequence CCGTGATCACCCTGGTCACACTG GGCCACGTTCTCCTGCAGGACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 230} {0: 2, 1: 0, 2: 0, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!