ID: 1166007085_1166007092

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1166007085 1166007092
Species Human (GRCh38) Human (GRCh38)
Location 19:39915363-39915385 19:39915400-39915422
Sequence CCCATGAAGTCGAAGCGCCGGCC AGTGTGGGTCCCCGGACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 14} {0: 1, 1: 0, 2: 2, 3: 17, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!