ID: 1166037217_1166037226

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1166037217 1166037226
Species Human (GRCh38) Human (GRCh38)
Location 19:40177566-40177588 19:40177619-40177641
Sequence CCTTGAAAAACCCTAGCCTCCAA TCCTGTTCTTCTCACTTGACTGG
Strand - +
Off-target summary {0: 12, 1: 44, 2: 105, 3: 182, 4: 415} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!