ID: 1166043234_1166043250

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1166043234 1166043250
Species Human (GRCh38) Human (GRCh38)
Location 19:40215363-40215385 19:40215405-40215427
Sequence CCACAAGGTGGGGGAGGCCCTGG TATTGGGGAAGGAGGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 406} {0: 1, 1: 0, 2: 22, 3: 234, 4: 2009}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!