ID: 1166043603_1166043614

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1166043603 1166043614
Species Human (GRCh38) Human (GRCh38)
Location 19:40217176-40217198 19:40217226-40217248
Sequence CCGCCACTCACCTGTGGGTTCCC GCGCGCGTGCGTAGTCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 235} {0: 1, 1: 0, 2: 1, 3: 1, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!