ID: 1166043876_1166043894

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1166043876 1166043894
Species Human (GRCh38) Human (GRCh38)
Location 19:40218248-40218270 19:40218289-40218311
Sequence CCGGGACGAGCCGAGCCATGGCG CGAGCCCGGTGGGGAGAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61} {0: 1, 1: 0, 2: 5, 3: 37, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!