ID: 1166043879_1166043894

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1166043879 1166043894
Species Human (GRCh38) Human (GRCh38)
Location 19:40218258-40218280 19:40218289-40218311
Sequence CCGAGCCATGGCGGGAGCCCGAG CGAGCCCGGTGGGGAGAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 150} {0: 1, 1: 0, 2: 5, 3: 37, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!