ID: 1166046127_1166046142

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1166046127 1166046142
Species Human (GRCh38) Human (GRCh38)
Location 19:40232189-40232211 19:40232236-40232258
Sequence CCCAGCTGCCCTCACCCTGAGCT CGGCTAGTACAGGAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 412} {0: 1, 1: 0, 2: 0, 3: 20, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!