ID: 1166048009_1166048012 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1166048009 | 1166048012 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 19:40241036-40241058 | 19:40241056-40241078 |
| Sequence | CCTCAGCCTTCTAAAGTGCTGGA | GGAATTACAGGCGTGAGCTGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 20, 2: 249, 3: 3131, 4: 6256} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||