ID: 1166053350_1166053355

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1166053350 1166053355
Species Human (GRCh38) Human (GRCh38)
Location 19:40274241-40274263 19:40274257-40274279
Sequence CCTAGCCCCCACTGTGTCCCCAG TCCCCAGCTCCACTCAGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 5, 3: 41, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!