ID: 1166074050_1166074062

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1166074050 1166074062
Species Human (GRCh38) Human (GRCh38)
Location 19:40403691-40403713 19:40403713-40403735
Sequence CCCGGGCCCGCCCACCTTCCTGC CAGGCTGAGGCTCCTGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 551} {0: 1, 1: 0, 2: 1, 3: 26, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!