ID: 1166097385_1166097401

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1166097385 1166097401
Species Human (GRCh38) Human (GRCh38)
Location 19:40549383-40549405 19:40549426-40549448
Sequence CCAGGTGGCGCACGACCTGGACG CAGGGGCCTGGGGCGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 2, 2: 27, 3: 285, 4: 2400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!