ID: 1166100288_1166100292

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1166100288 1166100292
Species Human (GRCh38) Human (GRCh38)
Location 19:40567736-40567758 19:40567756-40567778
Sequence CCACGGAACTGGCGGCCAAGGCG GCGGCGCCCCTGCTGCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51} {0: 1, 1: 0, 2: 2, 3: 30, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!