ID: 1166107675_1166107684

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1166107675 1166107684
Species Human (GRCh38) Human (GRCh38)
Location 19:40605399-40605421 19:40605439-40605461
Sequence CCCTAGGCGTGGCATCTATGGTG CCCGCAGGAGGCGTCGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 33} {0: 1, 1: 0, 2: 2, 3: 23, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!