ID: 1166108855_1166108859

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166108855 1166108859
Species Human (GRCh38) Human (GRCh38)
Location 19:40610832-40610854 19:40610868-40610890
Sequence CCAAGTGATGGGAAACAGAAAGG GATGGAGAAGCAGAATGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 279} {0: 1, 1: 0, 2: 10, 3: 212, 4: 2269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!