ID: 1166137570_1166137578

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1166137570 1166137578
Species Human (GRCh38) Human (GRCh38)
Location 19:40786642-40786664 19:40786687-40786709
Sequence CCTCAGAGTGTGTGCCCCTGCAG CGCTCTCACAGGCGAGAACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 269} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!