ID: 1166137571_1166137579

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1166137571 1166137579
Species Human (GRCh38) Human (GRCh38)
Location 19:40786656-40786678 19:40786690-40786712
Sequence CCCCTGCAGAGCTGATGTTCCTG TCTCACAGGCGAGAACGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 300} {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!