ID: 1166157387_1166157391

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1166157387 1166157391
Species Human (GRCh38) Human (GRCh38)
Location 19:40924228-40924250 19:40924254-40924276
Sequence CCAGTTAGAGGCTGCAGTGGGGT GGGCAGTCAGACTGGAACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 60, 4: 271} {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!