ID: 1166173856_1166173861

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1166173856 1166173861
Species Human (GRCh38) Human (GRCh38)
Location 19:41051541-41051563 19:41051582-41051604
Sequence CCCTGCTGCTTGTGTTCATACAG TTTTGGCATTTTAAAATGGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!