ID: 1166176787_1166176790 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1166176787 | 1166176790 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 19:41078875-41078897 | 19:41078898-41078920 |
| Sequence | CCAGATCTCATTTAAACTGAGTG | AGAACCCACTCATCACCAAGGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 7, 1: 113, 2: 340, 3: 617, 4: 1084} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||