ID: 1166177756_1166177762

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166177756 1166177762
Species Human (GRCh38) Human (GRCh38)
Location 19:41086906-41086928 19:41086933-41086955
Sequence CCAGCTCCCTCACTTACTCCCTG ACCTCACTCAAGAGGATTTATGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 6, 3: 86, 4: 942} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!