ID: 1166204788_1166204801

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1166204788 1166204801
Species Human (GRCh38) Human (GRCh38)
Location 19:41262685-41262707 19:41262737-41262759
Sequence CCTGCCTCTGCGGACCGTAGTGG CCCAAAGCAGATCGGAATTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62} {0: 1, 1: 0, 2: 2, 3: 17, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!