ID: 1166228923_1166228932

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1166228923 1166228932
Species Human (GRCh38) Human (GRCh38)
Location 19:41414279-41414301 19:41414300-41414322
Sequence CCAAGCAAGAAAGAGACAAGCCA CAGGGTTAGGACTCTGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 328} {0: 1, 1: 0, 2: 3, 3: 19, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!