ID: 1166254810_1166254823

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1166254810 1166254823
Species Human (GRCh38) Human (GRCh38)
Location 19:41595991-41596013 19:41596035-41596057
Sequence CCTTCCCTTGGCCATTTCCCACA ACCCTCTGATCACTTTCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!