ID: 1166267014_1166267028

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1166267014 1166267028
Species Human (GRCh38) Human (GRCh38)
Location 19:41690668-41690690 19:41690689-41690711
Sequence CCACAGCCAGGAGCCCCCATCTC TCCAGGGACCCTCGGGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 43, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!