ID: 1166269738_1166269750

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1166269738 1166269750
Species Human (GRCh38) Human (GRCh38)
Location 19:41706810-41706832 19:41706849-41706871
Sequence CCCACTTCCCTCCTGTCCACCAG TCCCACCCTGGAGCCTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 55, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!