ID: 1166290554_1166290559 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1166290554 | 1166290559 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 19:41860546-41860568 | 19:41860580-41860602 |
Sequence | CCTCACACGCAGGGGCCGGGCTC | TCCAGAGAGGCCGTGGGCGTCGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 10, 4: 161} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |