ID: 1166327882_1166327891

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1166327882 1166327891
Species Human (GRCh38) Human (GRCh38)
Location 19:42062374-42062396 19:42062400-42062422
Sequence CCTGGGTGCCCCAGGGTTCTAAC GGGGCAGTGAACCACTGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153} {0: 1, 1: 0, 2: 3, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!