ID: 1166331171_1166331176

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166331171 1166331176
Species Human (GRCh38) Human (GRCh38)
Location 19:42078873-42078895 19:42078900-42078922
Sequence CCAGCTCCTGGAGCACCAGGAGC CCTGAAGATGATGGCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 437} {0: 1, 1: 0, 2: 1, 3: 21, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!