ID: 1166342098_1166342103

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1166342098 1166342103
Species Human (GRCh38) Human (GRCh38)
Location 19:42144345-42144367 19:42144371-42144393
Sequence CCTGCAAAAGGGAGCTAATGGGA CCCACCTGGCCTCACAAGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!