ID: 1166364644_1166364651

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1166364644 1166364651
Species Human (GRCh38) Human (GRCh38)
Location 19:42272350-42272372 19:42272380-42272402
Sequence CCCTGGCAGCACCAGTGGCAGCT GCGGCAGCTGCGGTCCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 322} {0: 1, 1: 0, 2: 0, 3: 21, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!