ID: 1166368587_1166368596

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1166368587 1166368596
Species Human (GRCh38) Human (GRCh38)
Location 19:42289621-42289643 19:42289666-42289688
Sequence CCAGATCTTCAGGTGCAGTGTTA TAGGCTCCTGCACTGGGCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!