ID: 1166381348_1166381351

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1166381348 1166381351
Species Human (GRCh38) Human (GRCh38)
Location 19:42356846-42356868 19:42356859-42356881
Sequence CCGCTCCTTCCATGCAGCCGCAT GCAGCCGCATATGTGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154} {0: 1, 1: 0, 2: 0, 3: 0, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!