ID: 1166382395_1166382406

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1166382395 1166382406
Species Human (GRCh38) Human (GRCh38)
Location 19:42361896-42361918 19:42361935-42361957
Sequence CCAGCGTCTCCAGCCTGGGTGAC ATCTATTACCAAATGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 39, 3: 336, 4: 2263} {0: 1, 1: 0, 2: 0, 3: 16, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!