ID: 1166391333_1166391338

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1166391333 1166391338
Species Human (GRCh38) Human (GRCh38)
Location 19:42410477-42410499 19:42410490-42410512
Sequence CCAGGTAGGCCTCCAGCTCGGCC CAGCTCGGCCAGGTTGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 193} {0: 1, 1: 0, 2: 0, 3: 32, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!