ID: 1166395690_1166395694

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1166395690 1166395694
Species Human (GRCh38) Human (GRCh38)
Location 19:42438906-42438928 19:42438956-42438978
Sequence CCATAAATACTCATGAGTCCATG AAATAAATAAGGAAGAGGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 181, 4: 1583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!