ID: 1166406775_1166406780

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1166406775 1166406780
Species Human (GRCh38) Human (GRCh38)
Location 19:42527254-42527276 19:42527267-42527289
Sequence CCCCTTTGTACCAGCTGTAGCCA GCTGTAGCCAAAAAGTTGCTGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 5, 3: 8, 4: 114} {0: 1, 1: 2, 2: 1, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!