ID: 1166406775_1166406784

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1166406775 1166406784
Species Human (GRCh38) Human (GRCh38)
Location 19:42527254-42527276 19:42527284-42527306
Sequence CCCCTTTGTACCAGCTGTAGCCA GCTGGGGCAGATTGTGGACAAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 5, 3: 8, 4: 114} {0: 1, 1: 0, 2: 2, 3: 25, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!